Top » Catalog » SNPs » Y22559

$18.00

Y22559
[Y22559]

Y22559
hg38 Position: ChrY:14139246..14139246
Ancestral: A
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: T1a1a1a (not listed)
Comments: Below Y6671
Forward Primer: Y22559_F TGCATGCTTGTTGTTGTATTTG
Reverse Primer: Y22559_R GCAACACAAAACTATTTCACTGC
Reviews

Customers who bought this product also purchased
PF7444
PF7444
Z709
Z709
BY28361
BY28361
Y6671
Y6671
BY28252
BY28252
CTS11451
CTS11451
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies