Top » Catalog » SNPs » Y22559

$18.00

Y22559
[Y22559]

Y22559
hg38 Position: ChrY:14139246..14139246
Ancestral: A
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: T1a1a1a (not listed)
Comments: Below Y6671
Forward Primer: Y22559_F TGCATGCTTGTTGTTGTATTTG
Reverse Primer: Y22559_R GCAACACAAAACTATTTCACTGC
Reviews

Customers who bought this product also purchased
Y6671
Y6671
BY28252
BY28252
CTS11451
CTS11451
BY11471
BY11471
T Superclade Panel
T Superclade Panel
PF7443
PF7443
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies