Top » Catalog » SNPs » L338

$18.00

L338
[L338]

L338
hg38 Position: ChrY:16980718..16980718
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: I1a2a1a1a1
Comments: Found in a hg I-M253* WTY participant
Forward Primer: L338_F GGAAGCAAAATGTCTGCTGG
Reverse Primer: L338_R TTCCCTTCACTTCAAGACTGC
Reviews

Customers who bought this product also purchased
S1954
S1954
Z2535
Z2535
BY464
BY464
CDY
CDY
BY461
BY461
DYS464
DYS464
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies