Top » Catalog » SNPs » L338

$18.00

L338
[L338]

L338
hg38 Position: ChrY:16980718..16980718
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: I1a2a1a1a1
Comments: Found in a hg I-M253* WTY participant
Forward Primer: L338_F GGAAGCAAAATGTCTGCTGG
Reverse Primer: L338_R TTCCCTTCACTTCAAGACTGC
Reviews

Customers who bought this product also purchased
A5679
A5679
YSC0000261
YSC0000261
YSC0000260
YSC0000260
FT68679
FT68679
A2404
A2404
A1934
A1934
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies