Top » Catalog » SNPs » SK893

$18.00

SK893
[SK893]

SK893
HG19 Position: ChrY:17163906..17163906
Ancestral: C
Derived: G
Reference: Mark Stoneking and Ryan Wei (2014)
ISOGG Haplogroup: E1b1b1a1c*
Comments: Below V13 > Y16729
Forward Primer: SK893_F GCCTGAAAAGATATAGGGAAGCT
Reverse Primer: SK893_R GGGAAAACTTCAGCATGGTTATG
Reviews

Customers who bought this product also purchased
Y16729
Y16729
E1b-V13 Panel
E1b-V13 Panel
M35.2
M35.2
Z38518
Z38518
S3003
S3003
Y16721
Y16721
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies