Top » Catalog » SNPs » SK893

$18.00

SK893
[SK893]

SK893
HG19 Position: ChrY:17163906..17163906
Ancestral: C
Derived: G
Reference: Mark Stoneking and Ryan Wei (2014)
ISOGG Haplogroup: E1b1b1a1c*
Comments: Below V13 > Y16729
Forward Primer: SK893_F GCCTGAAAAGATATAGGGAAGCT
Reverse Primer: SK893_R GGGAAAACTTCAGCATGGTTATG
Reviews

Customers who bought this product also purchased
CTS5856
CTS5856
BY5814
BY5814
Z5018
Z5018
BY5796
BY5796
Z5017
Z5017
Y16729
Y16729
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies