Top » Catalog » SNPs » S3251

$18.00

S3251
[S3251]

S3251
hg38 Position: ChrY:9251025..9251025
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a1c2b1b (not listed)
Comments: Below Z159/Z160
Forward Primer: S3251v2_F GAGATTTTCTATGTCAAAAAATGGCT
Reverse Primer: S3251v2_R TCTGACCACCTAGGCCTCAC
Reviews

Customers who bought this product also purchased
FGC17297
FGC17297
FGC17296
FGC17296
S268
S268
Z301
Z301
Z17913
Z17913
FGC17302
FGC17302
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies