Top » Catalog » SNPs » S3251

$18.00

S3251
[S3251]

S3251
hg38 Position: ChrY:9251025..9251025
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a1c2b1b (not listed)
Comments: Below Z159/Z160
Forward Primer: S3251v2_F GAGATTTTCTATGTCAAAAAATGGCT
Reverse Primer: S3251v2_R TCTGACCACCTAGGCCTCAC
Reviews

Customers who bought this product also purchased
BY13042
BY13042
BZ2
BZ2
FGC6198
FGC6198
FGC8579
FGC8579
L163
L163
MZ29
MZ29
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies