Top » Catalog » SNPs » S3251

$17.50

S3251
[S3251]

S3251
HG19 Position: ChrY:9088634..9088634
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a1c2b1b (not listed)
Comments: Below Z159/Z160
Forward Primer: S3251v2_F GAGATTTTCTATGTCAAAAAATGGCT
Reverse Primer: S3251v2_R TCTGACCACCTAGGCCTCAC
Reviews

Customers who bought this product also purchased
FGC6198
FGC6198
BY13042
BY13042
BZ2
BZ2
FGC8587
FGC8587
FGC8573
FGC8573
FGC8579
FGC8579
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies