Top » Catalog » SNPs » MZ45

$18.00

MZ45
[MZ45]

MZ45
HG19 Position: ChrY:13443164..13443164
Ancestral: A
Derived: C
Reference: E-M81 community (2015)
ISOGG Haplogroup: E1b1b1b1a
Comments: Aka FGC22837. Below M81 > L351
Forward Primer: MZ45_F ACAGGCAAATGATGCCACAG
Reverse Primer: MZ45_R GCCAACAGCAGGCTCACA
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies