Top » Catalog » SNPs » A18711

$18.00

A18711
[A18711]

A18711
hg38 Position: ChrY:2931221..2931221
Ancestral: C
Derived: T
Reference: Nathaniel Austin Gray (2017)
ISOGG Haplogroup: I2a
Comments: Approx. BY13389
Forward Primer: A18711v2_F AGGCTGGTCTTGAACTTCTGAG
Reverse Primer: A18711v2_R CCAGGATAGTCTTGATTTCCTGAG
Reviews

Customers who bought this product also purchased
I2a-Y5282 Gray Segregation Panel
I2a-Y5282 Gray Segregation Panel
A18716
A18716
A18721
A18721
DNA Sample Kit
DNA Sample Kit
A18715
A18715
A18720
A18720
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies