Top » Catalog » SNPs » A18721

$18.00

A18721
[A18721]

A18721
hg38 Position: ChrY:15470084..15470084
Ancestral: T
Derived: A
Reference: Nathaniel Austin Gray (2017)
ISOGG Haplogroup: I2a (not listed)
Comments: Approx. BY13389
Forward Primer: A18721v2_F AGCTTATTTGTTCTATGGGTTGATG
Reverse Primer: A18721v2_R AGATAAAGCCAATATCAGGGGAC
Reviews

Customers who bought this product also purchased
A18717
A18717
A18711
A18711
A18716
A18716
I2a-Y5282 Gray Segregation Panel
I2a-Y5282 Gray Segregation Panel
A18715
A18715
A18720
A18720
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies