Top » Catalog » SNPs » BY10203

$18.00

BY10203
[BY10203]

BY10203
hg38 Position: ChrY:15679497..15679497
Ancestral: A
Derived: G
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b
Comments: Aka FGC22842. Below M81 > L351
Forward Primer: BY10203_F CATGTGGATGGCTGATTGG
Reverse Primer: BY10203_R AAGCACAACAAGGTGACAGG
Reviews

Customers who bought this product also purchased
BY10201
BY10201
BY10200
BY10200
FGC22840
FGC22840
BY10209
BY10209
BY10206
BY10206
BY10204
BY10204
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies