Top » Catalog » SNPs » A18789

$18.00

A18789
[A18789]

A18789
hg38 Position: ChrY:2833483..2833483
Ancestral: A
Derived: G
Reference: Jakub Krchak (2017)
ISOGG Haplogroup: I2
Comments: Below CTS10228 > S17250 > Y4882
Forward Primer: A18789_F AAAATTAGCTGGGCATGGTG
Reverse Primer: A18789_R TGGCTTTTTGGATGGATCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies