Top » Catalog » SNPs » A18793

$18.00

A18793
[A18793]

A18793
hg38 Position: ChrY:15828400..15828400
Ancestral: G
Derived: T
Reference: Jakub Krchak (2017)
ISOGG Haplogroup: I2
Comments: Below CTS10228 > S17250 > Y4882
Forward Primer: A18793_F AGCTGGGATTTACAGGCATC
Reverse Primer: A18793_R TCTGTCATTCCAGGCAAGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies