Top » Catalog » SNPs » FGC30452

$18.00

FGC30452
[FGC30452]

FGC30452
hg38 Position: ChrY:16962792..16962792
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: I2
Comments: Below CTS10228 > S17250 > Y4882 > Y16473
Forward Primer: FGC30452_F TTGCATCCTGTGGAAAATTG
Reverse Primer: FGC30452_R CCCACCAACAGTGTACAAGC
Reviews

Customers who bought this product also purchased
A5913
A5913
A20333
A20333
A19620
A19620
L1498
L1498
Y13568
Y13568
Y52621
Y52621
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies