Top » Catalog » SNPs » FGC30452

$18.00

FGC30452
[FGC30452]

FGC30452
hg38 Position: ChrY:16962792..16962792
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: I2
Comments: Below CTS10228 > S17250 > Y4882 > Y16473
Forward Primer: FGC30452_F TTGCATCCTGTGGAAAATTG
Reverse Primer: FGC30452_R CCCACCAACAGTGTACAAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies