Top » Catalog » SNPs » FGC30452

$18.00

FGC30452
[FGC30452]

FGC30452
hg38 Position: ChrY:16962792..16962792
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: I2
Comments: Below CTS10228 > S17250 > Y4882 > Y16473
Forward Primer: FGC30452_F TTGCATCCTGTGGAAAATTG
Reverse Primer: FGC30452_R CCCACCAACAGTGTACAAGC
Reviews

Customers who bought this product also purchased
PH908
PH908
Y3548
Y3548
A1328
A1328
S17250
S17250
Y16473
Y16473
CTS10228
CTS10228
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies