Top » Catalog » SNPs » ZQ192

$18.00

ZQ192
[ZQ192]

ZQ192
hg38 Position: ChrY:12428574..12428574
Ancestral: G
Derived: A
Reference: Gabit Baimbetov [ShejireDNA] (2017)
ISOGG Haplogroup: C2b1a2a
Comments: Below M48
Forward Primer: ZQ192_F ACAAGGAATAGCAAATAGCATTG
Reverse Primer: ZQ192_R GGTTGAGGCAGGAAGATCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies