Top » Catalog » SNPs » BY6728

$18.00

BY6728
[BY6728]

BY6728
hg38 Position: ChrY:16997190..16997190
Ancestral: T
Derived: A
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b
Comments: Aka FGC37185. Below V22 > L674 > Y16563 > FGC37181
Forward Primer: BY6728_F AAATGCATACAGGTGGACCAG
Reverse Primer: BY6728_R CATGTCTAGAAAACTCTCCTATGGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies