Top » Catalog » SNPs » A880

$18.00

A880
[A880]

A880
hg38 Position: ChrY:15154902..15154902
Ancestral: T
Derived: C
Reference: Wayne Kauffman (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A880_F GCATGGAATGTTCCTCCATTAC
Reverse Primer: A880_R GCACAAGACAGGGACGGC
Reviews

Customers who bought this product also purchased
A17986
A17986
A8818
A8818
A17987
A17987
A877
A877
A882
A882
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies