Top » Catalog » SNPs » BY21942

$18.00

BY21942
[BY21942]

BY21942
hg38 Position: ChrY:2941843..2941843
Ancestral: A
Derived: G
Reference: FTDNA (2017)
ISOGG Haplogroup: N
Comments: .
Forward Primer: BY21942_F CCTCTGGAATAGCTGGGACTAC
Reverse Primer: BY21942_R ACAGTTTATATTGGCGGAGGG
Reviews

Customers who bought this product also purchased
A18232
A18232
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies