Top » Catalog » SNPs » A18797

$18.00

A18797
[A18797]

A18797
hg38 Position: ChrY:12168753..12168753
Ancestral: G
Derived: T
Reference: Connie McKenzie (2017)
ISOGG Haplogroup: R1b
Comments: Below M222 > DF104 > A10656 > A10659
Forward Primer: A18797_F TTCCCCTTCCAGTGTTCAAG
Reverse Primer: A18797_R TCAGCCATTGTGGAAGACAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies