Top » Catalog » SNPs » A18799

$18.00

A18799
[A18799]

A18799
hg38 Position: ChrY:7993943..7993943
Ancestral: G
Derived: T
Reference: Connie McKenzie (2017)
ISOGG Haplogroup: R1b
Comments: Below M222 > DF104 > A10656 > A10659
Forward Primer: A18799_F TGTAATTAGGCCTGTGATATCCATC
Reverse Primer: A18799_R ATATAGGCATTATCACCTCCCCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies