Top » Catalog » SNPs » YFS4293919

$18.00

YFS4293919
[YFS4293919]

YFS4293919
hg38 Position: ChrY:11801541..11801541
Ancestral: A
Derived: T
Reference: Harold Eaton (2017)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: YFS4293919_F TCCTACCACAAAAGAAAAGTTGG
Reverse Primer: YFS4293919_R CGGTAATGAACACCCTCAGC
Reviews

Customers who bought this product also purchased
FGC7986
FGC7986
DYS463
DYS463
FGC5325
FGC5325
YSEQ-Gamma
YSEQ-Gamma
FGC5299
FGC5299
YSEQ-Delta
YSEQ-Delta
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies