Top » Catalog » SNPs » PH2651

$19.00

PH2651
[PH2651]

PH2651
hg38 Position: ChrY:14783727..14783727
Ancestral: T
Derived: G
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: J2
Comments: Below M67 > S8230
Forward Primer: PH2651_F TGGAAAGTTGGCAGTGCTC
Reverse Primer: PH2651_R TAGACCCTGGGGATGAATTG
Reviews (1)
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies