Top » Catalog » SNPs » FGC17110

$18.00

FGC17110
[FGC17110]

FGC17110
hg38 Position: ChrY:12254105..12254105
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: I1a1b1 (not listed)
Comments: Downstream of P109 > S7660> S14887 > FGC14514 > FGC14512; Aka Y6213
Forward Primer: FGC17110_F CGGTCTTACTGTTGCCAAGG
Reverse Primer: FGC17110_R TCTTTCCACCTGTGCCTTTC
Reviews

Customers who bought this product also purchased
FGC22115
FGC22115
FGC23560
FGC23560
FGC35959
FGC35959
A7626
A7626
FGC22113
FGC22113
FGC23559
FGC23559
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies