Top » Catalog » SNPs » FGC17110

$18.00

FGC17110
[FGC17110]

FGC17110
hg38 Position: ChrY:12254105..12254105
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: I1a1b1 (not listed)
Comments: Downstream of P109 > S7660> S14887 > FGC14514 > FGC14512; Aka Y6213
Forward Primer: FGC17110_F CGGTCTTACTGTTGCCAAGG
Reverse Primer: FGC17110_R TCTTTCCACCTGTGCCTTTC
Reviews

Customers who bought this product also purchased
FGC23547
FGC23547
Y33772
Y33772
A7628
A7628
FGC43220
FGC43220
FGC22112
FGC22112
Y34377
Y34377
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies