Top » Catalog » SNPs » FGC17110

$18.00

FGC17110
[FGC17110]

FGC17110
hg38 Position: ChrY:12254105..12254105
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: I1a1b1 (not listed)
Comments: Downstream of P109 > S7660> S14887 > FGC14514 > FGC14512; Aka Y6213
Forward Primer: FGC17110_F CGGTCTTACTGTTGCCAAGG
Reverse Primer: FGC17110_R TCTTTCCACCTGTGCCTTTC
Reviews

Customers who bought this product also purchased
FGC23549
FGC23549
FGC22110
FGC22110
FGC35957
FGC35957
FGC23548
FGC23548
FGC14507
FGC14507
FGC35955
FGC35955
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies