Top » Catalog » SNPs » PF6789

$18.00

PF6789
[PF6789]

PF6789
hg38 Position: ChrY:20963455..20963455
Ancestral: C
Derived: T
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: E (not listed)
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF6789_F TCTGGCAGGACAGTGACAAC
Reverse Primer: PF6789_R AGCTAGGATCTGCGCAACAG
Reviews (1)

Customers who bought this product also purchased
BY198035
BY198035
A5604
A5604
BY74692
BY74692
M165
M165
Z27803
Z27803
M5343
M5343
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies