Top » Catalog » SNPs » PF6789

$18.00

PF6789
[PF6789]

PF6789
hg38 Position: ChrY:20963455..20963455
Ancestral: C
Derived: T
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: E (not listed)
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF6789_F TCTGGCAGGACAGTGACAAC
Reverse Primer: PF6789_R AGCTAGGATCTGCGCAACAG
Reviews (1)

Customers who bought this product also purchased
MZ99
MZ99
M5043
M5043
L335
L335
Y141584
Y141584
Y22558
Y22558
Y190325
Y190325
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies