Top » Catalog » SNPs » HU564

$19.00

HU564
[HU564]

HU564
hg38 Position: ChrY:12375090..12375090
Ancestral: A
Derived: C
Reference: Faleh Hujailan (2017)
ISOGG Haplogroup: J1a
Comments: Downstream S782 > FGC22257 > FGC22259 > ZS6395 > FGC49350
Forward Primer: HU564_F AACCTTGAGCTAGATACAGAGTTCAGAC
Reverse Primer: HU564_R GAGGTGTGTCGGGAGAGG
Reviews

Customers who bought this product also purchased
FGC11
FGC11
FT394148
FT394148
Z2217
Z2217
Z28141
Z28141
FGC1695
FGC1695
ZS9830
ZS9830
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies