Top » Catalog » SNPs » HU564

$19.00

HU564
[HU564]

HU564
hg38 Position: ChrY:12375090..12375090
Ancestral: A
Derived: C
Reference: Faleh Hujailan (2017)
ISOGG Haplogroup: J1a
Comments: Downstream S782 > FGC22257 > FGC22259 > ZS6395 > FGC49350
Forward Primer: HU564_F AACCTTGAGCTAGATACAGAGTTCAGAC
Reverse Primer: HU564_R GAGGTGTGTCGGGAGAGG
Reviews

Customers who bought this product also purchased
A34243
A34243
L858
L858
Z18436
Z18436
ZS9859
ZS9859
FT394148
FT394148
FGC11
FGC11
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies