Top » Catalog » SNPs » A703

$18.00

A703
[A703]

A703
hg38 Position: ChrY:7543264..7543264
Ancestral: T
Derived: C
Reference: Bjorn Lamborn (2014)
ISOGG Haplogroup: N1c1a1a1a1 (not listed)
Comments: Found in a BigY
Forward Primer: A703_F GACACCAGGAATCGAATTCG
Reverse Primer: A703_R GCCATTGGTTAAATGTTGTGG
Reviews

Customers who bought this product also purchased
A704
A704
A709
A709
A918
A918
A708
A708
A917
A917
A707
A707
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies