Top » Catalog » SNPs » A18931

$18.00

A18931
[A18931]

A18931
hg38 Position: ChrY:11530608..11530608
Ancestral: G
Derived: T
Reference: Nasser Alanazi (2017)
ISOGG Haplogroup: J1
Comments: Downstream BY8 > BY9 > BY136 > ZS2003 > ZS2006
Forward Primer: A18931_F AGTGGAGTGGAATGGACGAG
Reverse Primer: A18931_R TCGAATGAATTGTTTTGAGACC
Reviews

Customers who bought this product also purchased
A18937
A18937
FGC57568
FGC57568
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies