Top » Catalog » SNPs » A18940

$18.00

A18940
[A18940]

A18940
hg38 Position: ChrY:17177537..17177537
Ancestral: C
Derived: G
Reference: Nasser Alanazi (2017)
ISOGG Haplogroup: J1
Comments: Downstream BY8 > BY9 > BY136 > ZS2003 > ZS2006 > ZS2010.
Forward Primer: A18940_F CACAAGGAGAAGAAGAAGACAGC
Reverse Primer: A18940_R GAGCTTTTAAAAACACAAAAATATTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies