Top » Catalog » SNPs » A18898

$18.00

A18898
[A18898]

A18898
hg38 Position: ChrY:14308539..14308539
Ancestral: C
Derived: A
Reference: Petr Soucek (2017)
ISOGG Haplogroup: T1a
Comments: Below PF4074
Forward Primer: A18898_F GGTTGAAACACCCACCAGAG
Reverse Primer: A18898_R CAAAGGTCAGCCAATAAATGC
Reviews

Customers who bought this product also purchased
A19089
A19089
BY2099
BY2099
A19078
A19078
A19146
A19146
A19076
A19076
A19144
A19144
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies