Top » Catalog » SNPs » Y31512

$18.00

Y31512
[Y31512]

Y31512
hg38 Position: ChrY:16868711..16868711
Ancestral: A
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: R2
Comments: Below L1069
Forward Primer: Y31512_F TCCTTTGCTAAGTTTTAGACTCTAATAAAAC
Reverse Primer: Y31512_R CCCAATATCTTGGCTCACACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies