Top » Catalog » SNPs » ZS6418

$18.00

ZS6418
[ZS6418]

ZS6418
hg38 Position: ChrY:26595380..26595380
Ancestral: T
Derived: C
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: downstream Z18218
Forward Primer: ZS6418_F TGCATTGTCAAATGTCCTGTG
Reverse Primer: ZS6418_R CCCAGAATTTTTCTGAGTGTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies