Top » Catalog » SNPs » A19077

$18.00

A19077
[A19077]

A19077
hg38 Position: ChrY:6931024..6931024
Ancestral: G
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP942
Forward Primer: A19077v2_F TTGTTCTTTTGAGCTTCACAATAGAG
Reverse Primer: A19077v2_R GGAGAAGCTGGGATTATAGACATG
Reviews

Customers who bought this product also purchased
A19126
A19126
FGC21105
FGC21105
FGC21110
FGC21110
A19084
A19084
A19155
A19155
A19102
A19102
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies