Top » Catalog » SNPs » A19161

$18.00

A19161
[A19161]

A19161
hg38 Position: ChrY:15130357..15130357
Ancestral: A
Derived: C
Reference: Had Amli (2017)
ISOGG Haplogroup: J1
Comments: Approx. FGC68217
Forward Primer: A19161_F GATATCCCCCTTGTTATTCTTGC
Reverse Primer: A19161_R GATAGAGATTCTATTGAACAGTTTTCTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies