Top » Catalog » SNPs » A19163

$18.00

A19163
[A19163]

A19163
hg38 Position: ChrY:13151478..13151478
Ancestral: C
Derived: G
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below PF4135
Forward Primer: A19163_F TCAATGCTGACAATCTTGGTTC
Reverse Primer: A19163_R GGCAACTTTGATCCAAAAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies