Top » Catalog » SNPs » A705

$18.00

A705
[A705]

A705
hg38 Position: ChrY:12528170..12528170
Ancestral: T
Derived: G
Reference: Bjorn Lamborn (2014)
ISOGG Haplogroup: N1c1a1a1a1 (not listed)
Comments: Below L1025. with Y4706
Forward Primer: A705_F ACTTGCGGCATTTCATATTG
Reverse Primer: A705_R TTCGACCAGTTTGGGTAAATC
Reviews

Customers who bought this product also purchased
Y139030
Y139030
Y4342
Y4342
CTS6904
CTS6904
BY21893
BY21893
L395
L395
Y4708
Y4708
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies