Top » Catalog » SNPs » A705

$18.00

A705
[A705]

A705
hg38 Position: ChrY:12528170..12528170
Ancestral: T
Derived: G
Reference: Bjorn Lamborn (2014)
ISOGG Haplogroup: N1c1a1a1a1 (not listed)
Comments: Below L1025. with Y4706
Forward Primer: A705_F ACTTGCGGCATTTCATATTG
Reverse Primer: A705_R TTCGACCAGTTTGGGTAAATC
Reviews

Customers who bought this product also purchased
Y139030
Y139030
Y4708
Y4708
N Superclade Panel
N Superclade Panel
Y7795
Y7795
FGC14542
FGC14542
Y4342
Y4342
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies