Top » Catalog » SNPs » FGC48180

$18.00

FGC48180
[FGC48180]

FGC48180
hg38 Position: ChrY:13710730..13710730
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1a
Comments: Below FGC5423 > FGC33172
Forward Primer: FGC48180_F CCACACTTTTGGCCATATTTC
Reverse Primer: FGC48180_R TCCTGCATCAATTGAAACAATC
Reviews

Customers who bought this product also purchased
BY145
BY145
FGC4486
FGC4486
DNA Sample Kit
DNA Sample Kit
ZS5205
ZS5205
FGC5424
FGC5424
FGC11
FGC11
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies