Top » Catalog » SNPs » A708

$18.00

A708
[A708]

A708
hg38 Position: ChrY:15961177..15961177
Ancestral: G
Derived: T
Reference: Bjorn Lamborn (2014)
ISOGG Haplogroup: N1c1a1a1a1 (not listed)
Comments: Below L1025. with Y4706
Forward Primer: A708_F GGTTCAAGGCATTCTGCTTC
Reverse Primer: A708_R AAGTAATCCCATCCCTCATCC
Reviews

Customers who bought this product also purchased
A703
A703
A709
A709
A918
A918
A707
A707
A917
A917
A706
A706
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies