Top » Catalog » SNPs » A19130

$18.00

A19130
[A19130]

A19130
hg38 Position: ChrY:16148577..16148577
Ancestral: T
Derived: G
Reference: Petr Soucek (2017)
ISOGG Haplogroup: J2b
Comments: Y12007
Forward Primer: FGC7509_F CATGACTGGGATGGTGATTG
Reverse Primer: FGC7509_R GGCATGATCACAGCTCACAG
Reviews

Customers who bought this product also purchased
A19111
A19111
A19136
A19136
A19092
A19092
A19151
A19151
A19108
A19108
A19135
A19135
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies