Top » Catalog » SNPs » A19263

$18.00

A19263
[A19263]

A19263
hg38 Position: ChrY:7454960..7454960
Ancestral: C
Derived: A
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19263_F GAGGGTGGAGCCTCATAGG
Reverse Primer: A19263_R TGGAAGGGAACTCAAATTAAAGATG
Reviews

Customers who bought this product also purchased
HU406
HU406
A19279
A19279
J1a-ZS1820 Zhibian Panel
J1a-ZS1820 Zhibian Panel
A19265
A19265
HU400
HU400
A19272
A19272
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies