Top » Catalog » SNPs » A19266

$18.00

A19266
[A19266]

A19266
hg38 Position: ChrY:11330664..11330664
Ancestral: G
Derived: A
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19266_F CAGAGCCTAGAGAAGAGTTATATGACTG
Reverse Primer: A19266_R TCTACGGGGCATAATGACATATC
Reviews

Customers who bought this product also purchased
A22919
A22919
A22918
A22918
Y154840
Y154840
HU407
HU407
A19280
A19280
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies