Top » Catalog » SNPs » A19271

$18.00

A19271
[A19271]

A19271
hg38 Position: ChrY:14257133..14257133
Ancestral: T
Derived: A
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19271_F GACAGGGACAAAGGATGGAG
Reverse Primer: A19271_R GCATCCAACATGGGAGAAAG
Reviews

Customers who bought this product also purchased
WGS
WGS
A22924
A22924
Y154841
Y154841
A22925
A22925
HU406
HU406
A19279
A19279
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies