Top » Catalog » SNPs » A19271

$18.00

A19271
[A19271]

A19271
hg38 Position: ChrY:14257133..14257133
Ancestral: T
Derived: A
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19271_F GACAGGGACAAAGGATGGAG
Reverse Primer: A19271_R GCATCCAACATGGGAGAAAG
Reviews

Customers who bought this product also purchased
A22925
A22925
Whole Genome Sequence 45 GBases
Whole Genome Sequence 45 GBases
A22924
A22924
Y154841
Y154841
A19265
A19265
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies