Top » Catalog » SNPs » A19274

$18.00

A19274
[A19274]

A19274
hg38 Position: ChrY:16679282..16679282
Ancestral: A
Derived: G
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19274_F GGCAATCAGCCATTTGATTC
Reverse Primer: A19274_R AATTGAAGGTGCCGAGAGTC
Reviews

Customers who bought this product also purchased
J1a-ZS1820 Zhibian Panel
J1a-ZS1820 Zhibian Panel
A19264
A19264
HU400
HU400
A19271
A19271
HU405
HU405
A19278
A19278
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19144
1 x PH768
1 x FGC41138
$54.00
Haplogroup Info
Other products
Currencies