Top » Catalog » SNPs » A19276

$18.00

A19276
[A19276]

A19276
hg38 Position: ChrY:20568766..20568766
Ancestral: C
Derived: A
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19276_F CGAAGGAGCTCTTCAAGGTG
Reverse Primer: A19276_R TGTGCTTCTCAGTCCCCTTC
Reviews

Customers who bought this product also purchased
HU403
HU403
A19275
A19275
HU408
HU408
A19281
A19281
HU397
HU397
A19266
A19266
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies