Top » Catalog » SNPs » A710

$18.00

A710
[A710]

A710
hg38 Position: ChrY:7486561..7486561
Ancestral: G
Derived: A
Reference: Bjorn Lamborn (2014)
ISOGG Haplogroup: N1c1a1a1a1 (not listed)
Comments: Below L1025. with Y4706
Forward Primer: A710_F ATGGTGACCATAGTTAATACTAAGGTAACA
Reverse Primer: A710_R GGATCTTGGCTAACTGCAATC
Reviews

Customers who bought this product also purchased
A704
A704
A709
A709
A703
A703
A708
A708
A918
A918
A707
A707
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies