Top » Catalog » SNPs » A19281

$18.00

A19281
[A19281]

A19281
hg38 Position: ChrY:26630620..26630620
Ancestral: C
Derived: A
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19281_F AGTTACTGTTTAATGGGTACATAGTTTCTG
Reverse Primer: A19281_R AATATTTCTCCAATATCTTCAAAATTAAAACAG
Reviews

Customers who bought this product also purchased
HU406
HU406
A19278
A19278
J1a-ZS1820 Zhibian Panel
J1a-ZS1820 Zhibian Panel
A19264
A19264
HU400
HU400
A19271
A19271
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies